Resistance to Beta-lactams by Klebsiella Co-Producing Resistance Enzymes at the Pietro Annigoni Research Centre (CERBA)

Rhaina Olivia Badini; Amana Mètuor Dabiré; Rose Pêgdwendé Bonkoungou; Rabiétou Nikiéma; Bambara Eliada Lionel; Abdoul Karim Ouattara; Théodora Mahoukèdè Zohoncon; Jacques Simporé

doi:doi:10.11648/j.ajbio.20251306.13

Research Article |

| Peer-Reviewed

Resistance to Beta-lactams by Klebsiella Co-Producing Resistance Enzymes at the Pietro Annigoni Research Centre (CERBA)

Rhaina Olivia Badini^*

, Amana Mètuor Dabiré

, Rose Pêgdwendé Bonkoungou

, Rabiétou Nikiéma

, Bambara Eliada Lionel

, Abdoul Karim Ouattara

, Théodora Mahoukèdè Zohoncon

, Jacques Simporé

Published in American Journal of BioScience (Volume 13, Issue 6)

Received: 10 August 2025 Accepted: 20 August 2025 Published: 9 December 2025

Views: Downloads:

Download PDF

Share This Article

Twitter
Linked In
Facebook

Abstract

The misuse of antibiotics promotes the development of multi-resistance in bacteria both biochemically and genetically, as well as its ability to transmit to other bacteria. These microorganisms are capable of simultaneously producing resistance enzymes through resistance mechanisms that allow them to resist various classes of antibiotics at the same time and thus become multi-resistant. Our objective was to study resistance to beta-lactams by Klebsiella co-producing resistance enzymes isolated at the Pietro Annigoni Research Center (CERBA). The isolation and purification of bacterial strains isolated from stools, vaginal swabs and urine of internal and external patients of CERBA, were carried out on selective media and Muller Hinton (MH). The antibiogram was carried out according to the disk diffusion method. The API 20E biochemical gallery (Bio Mérieux, France) was used for the identification of enterobacteria and the bla_NDM, bla_SHV and bla_TOHO genes were detected by conventional Polymerase Chain Reaction (PCR). A total of one hundred and twenty-two (122) strains of Gram-negative bacilli were collected and identified. Among them we have 23.77% (29/122) strains of Klebsiella including 86.21% isolated from urine, 6.90% isolated from stool and 6.90% isolated from vaginal swab. The antibiogram showed that all 29 Klebsiella strains were resistant to at least one of the beta-lactams studied, including 93.10% resistance to amoxicillin plus clavulanic acid, 37.93% resistance to ceftazidime, 27.59% resistance to ceftriaxone, 44.83% to cefotaxime, 20.70% to imipenem and 24.14% to aztreonam. Among the 29 Klebsiella strains 24.13% were non-carriers of resistance genes and 76.86% of the strains were carriers of at least one of the resistance genes. However, 62.06% of Klebsiella strains harbor the bla _SHV gene, 41.38% of strains harbored bla_NDM versus 10.34% of strains carrying the bla _TOHO gene. Among the Klebsiella strains, 37.93% of the strains had coexistences of the genes, bla_SHV + bla_NDM, bla_SHV + bla_TOHO and bla_TOHO + bla_NDM respectively. However, the bla_SHV gene was most common in Klebsiella (Klebsiella sp and Klebsiella pneumoniae), followed by the bla _NDM gene and the bla _TOHO gene. This study has highlighted the multi-resistance of Klebsiella strains co-producing ESBLs of the bla_NDM, bla_SHV and bla_TOHO type. The co-production of genes by certain strains, particularly Klebsiella strains, requires the development of new strategies in scientific research in order to find effective therapeutic solutions to destroy multi-resistant bacteria.

Published in	American Journal of BioScience (Volume 13, Issue 6)
DOI	10.11648/j.ajbio.20251306.13
Page(s)	210-217
Creative Commons	This is an Open Access article, distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution and reproduction in any medium or format, provided the original work is properly cited.
Copyright	Copyright © The Author(s), 2025. Published by Science Publishing Group

Keywords

Multi-Resistance, Antibiotic, Enterobacteria, Klebsiella, Bla _NDM, Bla _SHV, Bla _TOHO, Co-Production

1. Introduction

Klebsiella species are Gram-negative, rod-shaped, non-motile, and usually encapsulated bacteria belonging to the family Enterobacteriaceae

[1]

Klebsiella that are pathogenic in humans include the following: K. pneumoniae; K. sp; K. oxytoca; K. granulomatis; K. variicola; and K. singaporensis. K. planticola, K. terrigena and K. orinthinolytica

[1]

Klebsiella species are important common pathogens, causing nosocomial pneumonia (7-14% of all cases), sepsis (4-15%), urinary tract infections (6-17%), wound infections (2-4%), intensive care unit (ICU) infections (4-17%), and neonatal sepsis (3-20%)

[1]

. Some Klebsiella strains, such as those producing carbapenemase (e.g., KPC - Klebsiella pneumoniae carbapenemase), can degrade carbapenem antibiotics (considered drugs of last resort). This makes these infections particularly difficult to treat. Klebsiella strains exhibit resistance to penicillins, particularly ampicillin and carbenicillin. Given that an increasing number of Klebsiella strains appear to produce extended-spectrum cephalosporinases, carbapenemases, and beta-lactamases, Klebsiella resistance to current antibiotics appears to be increasing.

antibiotics remain the most widely used class of antibiotics worldwide. This is primarily due to the number of available products covering a relatively broad bacterial spectrum. The mechanism of defense the more widespread And the more developed by bacteria against effects of These beta-lactams are produced by enzymes (beta-lactamases) that chemically modify the beta-lactams to make them inactive

[2]

Extended spectrum beta-lactamases (ESBLs) are mainly produced by Enterobacteriaceae, particularly Klebsiella pneumoniae

[3]

ESBL-carrying bacteria can also acquire and most often exhibit additional resistance to other classes of antibiotics such as monobactams (aztreonam), quinolones, tetracyclines, aminoglycosides

[4]

Our study focused on beta-lactam resistance in Klebsiella co-producing resistance enzymes at the Pietro Annigoni Research Centre (CERBA).

2. Materials and Methods

2.1. Framework of the Study

Our isolates were collected at the Pietro Annigoni Biomolecular Research Center (CERBA) in Ouagadougou. CERBA is a biomolecular research center located in Sector 51, District 11, Ouagadougou.

In-depth studies on the various isolates collected; such as identification, antibiotic sensitivity testing, and the search for ESBL genes using conventional PCR techniques were carried out at the Laboratory of Molecular Biology and Genetics (LABIOGENE). LABIOGENE is a research laboratory attached to the Doctoral School of Sciences and Technologies (ED/ST) of Joseph KI-ZERBO University.

2.1.1. Type of Study

This is a cross-sectional study of various ESBL-producing bacterial strains isolated at the Pietro Annigoni Biomolecular Research Center (CERBA) from March 1, 2024 to June 1, 2024.

2.1.2. Sampling

The samples selected were those received at the CERBA laboratory for bacteriological examinations and which, after analysis, detected the presence of enterobacteria. Pus, urine, stool, vaginal and vulvar samples were included in our study. The examination reports that were compliant included, among other things, the identity of the patient, the nature of the sample, the examination requested by the prescriber, the consultation and/or hospitalization service.

Samples collected in non-sterile equipment or suspected of any external soiling were excluded, as were samples collected the day before or days before for stool and urine samples.

2.2. Isolation and Identification of Gram-Negative Bacilli

Bacterial isolation was performed using selective media. Urine and stool samples were inoculated onto standard media (URI select, CLED, BCP, Hektoen, SS) and incubated for 24 h at 37°C. Biochemical tests were performed on suspect colonies using Kligler Hajna, mannitol-mobility, Simmons citrate, urea-indole and peptone water media.

The API 20E biochemical gallery (BioMérieux, France) was then used for the identification of Enterobacteriaceae according to the manufacturer's recommendations. The selected colonies were purified by culture at 37°C for 24 h on Muller-Hinton medium and used for antibiogram and DNA extraction.

2.3. Antibiotic Sensitivity Test

The Mueller-Hinton (MH) agar diffusion method was used for the antibiotic susceptibility test of strains according to the recommendations of the Antibiogram Committee of the French Society of Microbiology

[5]

. The i noculum Bacterial suspension was prepared by placing a pure colony in 5 ml of physiological saline. The suspension was then homogenized and calibrated to 0.5 McFarlane and then inoculated by tight streaks onto MH agar. The antibiotics were placed at a distance of approximately 20 mm from each other, at a rate of 4 discs per Petri dish. The different diameters of the inhibition zones obtained around the antibiotic discs were measured after 24 h of incubation at 37°C and compared to the CA-SFM standards to determine the sensitive (S), intermediate (I) and resistant (R) phenotypes. The antibiotics Ceftriaxone (CRO), Ceftazidime (CAZ), Cefotaxime (CTX), Imipenem (IMP), Amoxicillin + Clavulanic Acid (AMC) and Aztreonam (AT) were tested.

2.4. Extraction of Bacterial DNA

An isolated colony was picked from MH Petri dishes and suspended in 200 µl of distilled water in Eppendorf tubes. The tubes were then soaked in a 100°C water bath for 15 minutes to release the genetic material from the bacteria. After centrifugation for 10 min at 12000 rpm, the supernatants containing the released DNA were transferred to new Eppendorf tubes. The quantity and purity of the DNA extracts were determined by spectrophotometry using the NanoDrop. The DNA was stored at -80°C until PCR analyses.

2.5. PCR Amplification

bla _TOHO, bla _SHV, bla _NDM genes were detected by conventional PCR using the specific primer pairs presented in (Table 1). The PCR was carried out in a 20 μL reaction mixture including 4 μL of 5X FirepolMaster Mix; 0.5 μL of sense and antisense primer, 14 μL of PCR water and 1 μL of DNA extract from each strain. Amplification was carried out using the GeneAmp PCR System 9700 thermal cycler (Applied Biosystems, California, USA) according to the following program (Table 2): a first denaturation step at 96°C for 5 minutes, followed by 30 cycles for bla _NDM or 35 cycles for bla _TOHO and bla _SHV each including denaturation at 96°C for 30 seconds for bla _NDM and 1 minute for bla _TOHO and bla _SHV, hybridization at 62°C for 30 seconds for bla _NDM, 50°C and 60°C for 1 min respectively for bla _TOHO and bla _SHV and an elongation at 72°C for 30 seconds for bla _NDM or 1 mm for bla _TOHO and bla _SHV. Finally, a final elongation step was carried out at 72°C for 7 minutes for bla _NDM or 10 minutes for bla _TOHO and bla _SHV.

Table 1. Primer sequence for bla _SHV, bla _TOHO genes and blah_NDM.

Genoa	Primers	Sequences (5'- 3')	Sizes	References
Bla _SHV	Forward	ATG-CGT-TAT-ATT-CGC-CTG-TG	875 bp	(Pagani et al., 2003)
Bla _SHV	Reverse	TTA-GCG-TTG-CCA-GTG-CTC	875 bp	(Pagani et al., 2003)
Bla _TOHO	Forward	ATGTGCAGTACCAGTAA	876 bp	(Laurent et al., 1999)
Bla _TOHO	Reverse	TAGGTCACCAGAACCAG	876 bp	(Laurent et al., 1999)
Bla _NDM	Forward	CCATGCGGGCCGTATGAGTGATT	500 bp	(Mc Gann et al., 2012)
Bla _NDM	Reverse	AAGCTGAGCACGCATTAGCCG	500 bp	(Mc Gann et al., 2012)

Table 2. PCR program.

Genoa	Condition / duration
Settings	Bla _TOHO	Bla _SHV	Bla _NDM
Initial denaturation	96°C / 5 min	96°C / 5 min	96°C / 5 min
Denaturation	96°C / 1 min	96°C / 1 min	96°C / 30s
Hybridization	50°C / 1 min	60°C / 1 min	62°C / 30s
Elongation	72°C / 1 min	72°C / 1 min	72°C / 30s
Final elongation	72°C / 10 min	72°C /10 min	72°C /7 min
Number of cycles	35	35	30

2.6. Agarose Gel Electrophoresis

PCR-amplified DNA fragments were separated by electrophoresis on a 1% agarose gel prepared in a 1X tris base-borate-EDTA solution containing 0.5 μg/mL ethidium bromide. Migration was performed at 110 mV and 850 mA for 30 minutes. A 100 bp molecular weight marker was used to determine the size of the amplicons visualized under UV light using the GeneFlash device (Syngene, Bio-Imaging, UK).

3. Results

3.1. Distribution of Strains According to Samples

We obtained a total of 23.77% (29/122) of strains Klebsiella, of which 86.21% of strains were found in urine, 6.9% of strains were found in feces, and 6.9% of strains were found in vaginal swabs. However, many Klebsiella strains were isolated from urine (Figure 1).

Download: Download full-size image

Figure 1. Distribution of Klebsiella strains according to samples.

3.2. Resistance of Bacterial Strains to Antibiotics

Download: Download full-size image

Figure 2. Resistance and sensitivity profile of Klebsiella strains.

The antibiogram performed on each strain of Klebsiella allowed to study their resistance profiles with respect to the beta-lactams tested. The results of the study on the resistance of the 29 isolates of Klebsiella to different antibiotics show that 93.10% of the strains were resistant to Amoxicillin + clavulanic acid, 37.93% were resistant to Ceftazidime, 27.59% were resistant to Ceftriaxone, 44.83% were resistant to Cefotaxime, 20.70% were resistant to Imipenem, and 24.14% were resistant to Aztreonam (Figure 2).

3.3. Molecular Characterization of Resistance Genes

Classical PCR detection of bla _SHV, bla _NDM and bla _TOHO genes showed that 62.06% of strains harbored the bla _SHV gene, 41.38% of strains harbored the bla _NDM gene against 10.34% of strains carrying the bla _TOHO gene. The bla _SHV gene was the most frequent in Klebsiella (Klebsiella sp and Klebsiella pneumoniae) (Figure 3).

Download: Download full-size image

Figure 3. Distribution of genes in Klebsiella strains (Here, the shv gene was found much more frequently in Klebsiella strains, at 64.06%).

3.4. Distribution of Genes According to Samples

Strains carrying resistance genes were found much more frequently in urine, with 64% of strains carrying the SHV gene, 40% of strains carrying the NDM gene and 12% of strains carrying the TOHO gene (Figure 4).

Download: Download full-size image

Figure 4. Distribution of genes according to samples (Strains carrying resistance genes were found much more frequently in urine, with 64% of strains carrying the SHV gene, 40% of strains carrying the NDM gene and 12% of strains carrying the TOHO gene, the differences are statistically significant in these three groups).

3.5. Coexistence of Resistance Genes

PCR analysis also showed the bla _SHV genes and bla _NDM which were simultaneously found in 72.72% of the isolates. As for the double carriage of bla _TOHO genes and bla _SHV, it was observed in 18.18% of isolates against 9.09% with double carriage of bla _TOHO genes and bla _NDM observed in strains (Figure 5).

Download: Download full-size image

Figure 5. Coexistence of genes depending on bacterial strains.

4. Discussion

Klebsiella bacteria are equipped with plasmids, a fragment of DNA located outside the bacteria's chromosomes, which produce enzymes that attack antibiotics. These enzymes, beta-lactamases, have the ability to inactivate or destroy molecules that normally attack the bacterial cell wall, beta-lactams.

This war is not turning in favor of antibiotics since Klebsiella have been developing enzymes resistant to different types of beta-lactams for 30 years. The majority of strains were resistant to amoxicillin, a semi-synthetic penicillin, in combination with clavulanic acid which is a β-lactamase inhibitor

[6]

. The behavior of Klebsiella towards beta-lactamase inhibitors reports: 93.10% for amoxicillin-clavulanic acid (AMC) in our study, these results are respectively comparable to those of 98.7% at BATJECK in Rabat.

Resistance is certainly very high but not far from that obtained against this same antibiotic by Monzer Hamze in France, including 100% for AMC. Klebsiellae exhibit natural resistance to aminopenicillins by production of "a low-level penicillinase", corresponding to the wild-type phenotype

[7]

. This tendency towards resistance to aminopenicillins could be explained by the fact that the strains secrete broad-spectrum β-lactamases and high-level penicillinases.

Furthermore, the production of chromosomal penicillinase of type SHV1 means that these strains are naturally resistant to aminopenicillins.

The frequencies of resistance of Klebsiella to 3rd cephalosporins reportedby our study were: 37.93% for Ceftazidime, 27.59% for Ceftriaxone, 44.83% for Cefotaxime. Our results are lower than those of BATJECK, with a resistance of 99.3% for cefotaxime (CTX); 93.3% for ceftriaxone (CRO); 94.9% for ceftazidime (CAZ). BATJECK's results in Rabat are practically similar to those obtained by Monzer Hamze in France.

On the other hand, Nawal found a resistance rate equal to 33.87%

[7]

, which is lower than the rate found in our results.

Imipenem has a strong activity against isolated Klebsiella strains with a resistance rate of 20.69%. Furthermore, Nawal found a resistance rate (8.06%) which is lower than that found in our study, Nawal's result is equivalent to that reported by

[8]

where no resistance to imipenem was observed.

Drug pressure in hospitals, poor treatment control, and the overuse of antibiotics, sometimes without medical prescription, are the main causes of the emergence and spread of multidrug-resistant pathogenic Enterobacteriaceae. In addition, acquired resistance has a high dissemination power due to its plasmid determinism. The resistance rate of Klebsiella to Aztreonam (monobactams) was 24.14%. Aztreonam resistance could be better explained by the presence of other resistance mechanisms, including AmpC β-lactamase or a combination of permeability defects and efflux mechanisms.

In the 1980s–1990s, the main resistance genes encoding extended-spectrum ß-lactamase enzymes associated with K. pneumoniae were derived from TEM and SHV ß-lactamases. A change in this global distribution is observed. ESBLs of the CTX-M type, and in particular CTX-M-15, initially associated with community-acquired Escherichia coli infections, are now increasingly isolated from K. pneumoniae

[9]

Bacteria use various resistance mechanisms such as inactivation of antibiotics by enzymes. The bla _SHV gene 62.06% was the most common in Klebsiella (Klebsiella sp and Klebsiella pneumoniae), followed by the bla_NDM gene 41.38% and the bla _TOHO gene 10.34%.

SHV-type beta-lactamases, including SHV-1 and at least twenty-three variants, generally exhibit extended-spectrum activity against newer broad-spectrum cephalosporins. Their likely ancestor is a chromosomal penicillinase from Klebsiella pneumoniae. SHV enzymes belong to the molecular class A of serine β-lactamases and share high functional and structural similarity with TEM β-lactamases

[10]

Bla _SHV -1 has spread, via plasmids, to virtually all species of enterobacteria but is most commonly found in Klebsiella pneumoniae.

New Delhi metallo-β-lactamase-1 (NDM-1) is an enzyme capable of hydrolyzing most β-lactam antibiotics. The bla _NDM1 gene is located on plasmids harboring multiple resistance determinants, thus conferring widespread drug resistance, leaving little to no therapeutic options

[11]

. Molecular characterization of NDM-type metallo-β-lactamases by PCR revealed that 41.38% carried the bla _NDM gene, this result is higher than that of Ouattara AK et al. With 10.00% (1/10) of the strains that carried the bla _NDM gene

[12]

K. pneumoniae strains has been reported in several countries

[12]

. The emergence of clinical strains of Klebsiella pneumoniae Co-producing KPC-2 and NDM-1 and resistant to carbapenems has also been reported in the literature

[13]

suggesting continued surveillance efforts and the imperative need for new therapeutic solutions to combat the expansion of multidrug resistance

[12]

. However, the utility of carbapenems is seriously threatened by the emergence of cabapenemases, including the newly characterized NDM1.

In a previous study in Burkina Faso, molecular characterization of 39 bacterial strains by PCR showed TOHO-type ESBLs in 25 isolates, 13 of which were Klebsiella pneumoniae

[14]

. On the other hand, our study found 3 Klebsiella strains that harbored the bla _TOHO gene. TOHO1 was an ESBL that achieved effective activity not only against penicillins but also against third-generation cephalosporins

[1]

The coexistence of bla _TOHO and bla _SHV genes was found in 18.18% of Klebsiella strains. Mètuor-Dabiré et al. reported the coexistence of bla _TOHO and bla _BES genes in Klebsiella pneumoniae (21.9%) at Saint Camille Hospital in Ouagadougou in 2019

[15]

. The coexistence of bla _SHV and bla _NDM genes as well as bla _TOHO and bla _NDM was found in 72.72% and 9.09% of the isolates in our study. A recent study in Egypt reported a high incidence of multidrug resistance with the emergence of the coexistence of bla _NDM-1 (70.0%) and bla _OXA-48 (52.0%) genes in carbapenem-resistant K. pneumoniae isolates

[16]

. This suggests that these genes are carried by the bacterial chromosome and/or plasmids promoting rapid spread both vertically and horizontally to bacteria of other species.

5. Conclusion

Multi-resistance of Klebsiella strains through co-production of resistance enzymes represents an enormous danger to public health, leading to therapeutic failures and the death of millions of people worldwide. This study identified bla_NDM, bla_SHV and bla_TOHO genes in ESBL co-producing Klebsiella strains isolated mainly from urine. The co-production of genes in the Klebsiella strain suggests a rapid spread of multi-resistance. This requires rapid development of new effective therapeutic combinations or solutions at the local level to prevent and combat bacterial multi-resistance in Burkina Faso.

Abbreviations

CERBA	Pietro Annigoni Research Center
MH	Muller Hinton
PCR	Polymerase Chain Reaction
SHV	Sulfhydryl Variable
NDM	New Delhi métallo-bêta-lactamase
KPC	Klebsiella pneumoniae Co-Producing KPC
ESBLs	Extended Spectrum Beta-Lactamases
CLED	Cystine Lactose Electrolyte Deficient
BCP	BromoCrésol Pourpre
SS	Salmonella-Shigella
DNA	Deoxyribonucleic Acid
CRO	Ceftriaxone
CAZ	Ceftazidime
CTX	Cefotaxime
IMP	Imipenem
AMC	Amoxicillin + Clavulanic Acid
AT	Aztreonam (AT)
TEM	Temoneira
EUCAST/ CASFM	European Committee on Antimicrobial Susceptibility Testing / Antibiogram Committee of the French Society of Microbiology

Author Contributions

Rhaina Olivia Badini: Conceptualization, Formal Analysis, Investigation, Methodology, Writing – original draft

Amana Mètuor Dabiré: Conceptualization, Formal Analysis, Investigation, Methodology, Supervision, Validation, Visualization

Rabiétou Nikiéma: Formal Analysis, Investigation, Methodology

Bambara Eliada Lionel: Formal Analysis, Investigation, Methodology

Abdoul Karim Ouattara: Formal Analysis, Investigation, Methodology, Supervision, Visualization

Théodora Mahoukèdè Zohoncon: Conceptualization, Formal Analysis, Methodology, Project administration, Supervision, Validation

Jacques Simporé: Conceptualization, Investigation, Supervision

Conflicts of Interest

The authors declare no conflicts of interest.

References

[1]	Janda, J. M., & Abbott, S. L. (2006). The Genera Klebsiella and Raoultella. The Enterobacteria (2nd ed., pp. 115-129). Washington, USA: ASM Press. https://doi.org/10.1128/JCM.21.1.46-76.1985
[2]	Walsh, F. (2003). Family Resilience: A Framework for Clinical Practice. Family Process, 42, 1-18. https://dx.doi.org/10.1111/j.1545-5300.2003.00001
[3]	Ahmadi, S. (2022). Recent studies on antimicrobial and anticancer activities of saponins: a mini-review. Nano Micro Biosystems, 1(1), 22-26. https://doi.org/10.1002/9781119711698.ch105
[4]	Tiemtoré, RYW, et al., Isolation and Identification of Escherichia coli and Klebsiella pneumoniae Strains Resistant to the Oxyimino-Cephalosporins and the Monobactam by Production of GES Type Extended Spectrum Beta-Lactamase (ESBL) at Saint Camille Hospital Center in Ouagadougou, Burkina Faso. Infect Drug Resist, 2022. 15: p. 3191-3204.
[5]	Eucast/Ca-Sfm (2021) Antibiogram Committee of the French Society of Microbiology.
[6]	Huttner, A., et al., Oral amoxicillin and amoxicillin-clavulanic acid: properties, indications and usage. Clin Microbiol Infect, 2020. 26(7): p. 871-879. https://doi.org/10.1016/j.cmi.2019.11.028
[7]	Nawal, B. O. U. R. A. S. Etude de la résistance aux antibiotiques des souches d’Escherichia coli et de Klebsiella pneumoniae isolées au laboratoire de l’EPH de Kolea (W. Tipaza). http://archives.univ-biskra.dz/handle/123456789/11706
[8]	N Sekhri-Arafa, F Smati - 2011 - Frequency and epidemiological markers of Klebsiella pneumoniae in high-risk infectious services at the Benbadis University Hospital in Constantine.
[9]	P Nordmann, L Poirel, TR Walsh, DM Livermore - The emerging NDM carbapenemases Trends in microbiology, 2011 - cell.com Figure 1 Worldwide distribution of identified cases of bacteria with NDM-1 enzyme as of 1 October 2011.
[10]	Castanheira, M., Kimbrough, J. H., DeVries, S., Mendes, R. E., & Sader, H. S. (2023, February). Trends of β-lactamase occurrence among Escherichia coli and Klebsiella pneumoniae in United States hospitals during a 5-year period and activity of antimicrobial agents against isolates stratified by β-lactamase type. In Open Forum Infectious Diseases (Vol. 10, No. 2, p. ofad038). US: Oxford University Press. https://doi.org/10.1093/ofid/ofad038
[11]	Bashir, T., & Ahmed, A. (2016). Colistin resistance among gram negative organisms; an evolving problem from tertiary care hospital, Pakistan 2014. American Journal of Microbiology. https://doi.org/10.3844/ajmsp.2016.29.31
[12]	AK Ouattara, B Ouédraogo, AM Dabiré, RYW Tiemtoré, S Sougué, J Simporé First Detection of NDM-type Carbapenemase-Producing K. pneumoniae isolated from Clinical Samples in Ouagadougou, Burkina Faso Archives of Microbiology & Immunology, 2023 https://doi.org/10.18527/20251213039
[13]	Gao H, Liu Y, Wang R, Wang Q, Jin L, and Wang H. The transferability and evolution of NDM-1 and KPC-2 co-producing Klebsiella pneumoniae from clinical settings. EbioMedicine (2020): 102599. https://doi.org/10.1016/j.ebiom.2019.102599
[14]	Sougué, S., Mètuor-Dabiré, A., Ouermi, D., Tiemtoré, Y. R. W. K., Sita, B. S. L. C., Zohoncon, T. M., ... & Simporé, J. (2021). Frequency of Antibiotic Resistance of Escherichia Coli and Klebsiella Pneumoniae by Production of TOHO-type β-lactamases at Saint Camille Hospital, Ouagadougou (Burkina Faso). Advances in Microbiology, 11(12), 713-722. https://doi.org/10.4236/aim.2021.1112051
[15]	Mètuor, DA, et al., Detection of multidrug-resistant enterobacteria simultaneously producing extended-spectrum -lactamases of the PER and GES types isolated at Saint Camille Hospital Center, Ouagadougou, Burkina Faso. African Journal of Microbiology Research, 2019.
[16]	El-Domany, R. A., El-Banna, T., Sonbol, F., & Abu-Sayedahmed, S. H. Co-existence of NDM-1 and OXA-48 genes in Carbapenem Resistant Klebsiella pneumoniae clinical isolates in Kafrelsheikh, Egypt. African health sciences, (2021) (2), 489-496. https://doi.org/10.4314/ahs.v21i2.2

Cite This Article

Plain Text BibTeX RIS

APA Style

Badini, R. O., Dabiré, A. M., Bonkoungou, R. P., Nikiéma, R., Lionel, B. E., et al. (2025). Resistance to Beta-lactams by Klebsiella Co-Producing Resistance Enzymes at the Pietro Annigoni Research Centre (CERBA). American Journal of BioScience, 13(6), 210-217. https://doi.org/10.11648/j.ajbio.20251306.13

Copy | Download

ACS Style

Badini, R. O.; Dabiré, A. M.; Bonkoungou, R. P.; Nikiéma, R.; Lionel, B. E., et al. Resistance to Beta-lactams by Klebsiella Co-Producing Resistance Enzymes at the Pietro Annigoni Research Centre (CERBA). Am. J. BioScience 2025, 13(6), 210-217. doi: 10.11648/j.ajbio.20251306.13

Copy | Download

AMA Style

Badini RO, Dabiré AM, Bonkoungou RP, Nikiéma R, Lionel BE, et al. Resistance to Beta-lactams by Klebsiella Co-Producing Resistance Enzymes at the Pietro Annigoni Research Centre (CERBA). Am J BioScience. 2025;13(6):210-217. doi: 10.11648/j.ajbio.20251306.13

Copy | Download

@article{10.11648/j.ajbio.20251306.13,
  author = {Rhaina Olivia Badini and Amana Mètuor Dabiré and Rose Pêgdwendé Bonkoungou and Rabiétou Nikiéma and Bambara Eliada Lionel and Abdoul Karim Ouattara and Théodora Mahoukèdè Zohoncon and Jacques Simporé},
  title = {Resistance to Beta-lactams by Klebsiella Co-Producing Resistance Enzymes at the Pietro Annigoni Research Centre (CERBA)},
  journal = {American Journal of BioScience},
  volume = {13},
  number = {6},
  pages = {210-217},
  doi = {10.11648/j.ajbio.20251306.13},
  url = {https://doi.org/10.11648/j.ajbio.20251306.13},
  eprint = {https://article.sciencepublishinggroup.com/pdf/10.11648.j.ajbio.20251306.13},
  abstract = {The misuse of antibiotics promotes the development of multi-resistance in bacteria both biochemically and genetically, as well as its ability to transmit to other bacteria. These microorganisms are capable of simultaneously producing resistance enzymes through resistance mechanisms that allow them to resist various classes of antibiotics at the same time and thus become multi-resistant. Our objective was to study resistance to beta-lactams by Klebsiella co-producing resistance enzymes isolated at the Pietro Annigoni Research Center (CERBA). The isolation and purification of bacterial strains isolated from stools, vaginal swabs and urine of internal and external patients of CERBA, were carried out on selective media and Muller Hinton (MH). The antibiogram was carried out according to the disk diffusion method. The API 20E biochemical gallery (Bio Mérieux, France) was used for the identification of enterobacteria and the blaNDM, blaSHV and blaTOHO genes were detected by conventional Polymerase Chain Reaction (PCR). A total of one hundred and twenty-two (122) strains of Gram-negative bacilli were collected and identified. Among them we have 23.77% (29/122) strains of Klebsiella including 86.21% isolated from urine, 6.90% isolated from stool and 6.90% isolated from vaginal swab. The antibiogram showed that all 29 Klebsiella strains were resistant to at least one of the beta-lactams studied, including 93.10% resistance to amoxicillin plus clavulanic acid, 37.93% resistance to ceftazidime, 27.59% resistance to ceftriaxone, 44.83% to cefotaxime, 20.70% to imipenem and 24.14% to aztreonam. Among the 29 Klebsiella strains 24.13% were non-carriers of resistance genes and 76.86% of the strains were carriers of at least one of the resistance genes. However, 62.06% of Klebsiella strains harbor the bla SHV gene, 41.38% of strains harbored blaNDM versus 10.34% of strains carrying the bla TOHO gene. Among the Klebsiella strains, 37.93% of the strains had coexistences of the genes, blaSHV + blaNDM, blaSHV + blaTOHO and blaTOHO + blaNDM respectively. However, the blaSHV gene was most common in Klebsiella (Klebsiella sp and Klebsiella pneumoniae), followed by the bla NDM gene and the bla TOHO gene. This study has highlighted the multi-resistance of Klebsiella strains co-producing ESBLs of the blaNDM, blaSHV and blaTOHO type. The co-production of genes by certain strains, particularly Klebsiella strains, requires the development of new strategies in scientific research in order to find effective therapeutic solutions to destroy multi-resistant bacteria.},
 year = {2025}
}

Copy | Download

TY  - JOUR
T1  - Resistance to Beta-lactams by Klebsiella Co-Producing Resistance Enzymes at the Pietro Annigoni Research Centre (CERBA)
AU  - Rhaina Olivia Badini
AU  - Amana Mètuor Dabiré
AU  - Rose Pêgdwendé Bonkoungou
AU  - Rabiétou Nikiéma
AU  - Bambara Eliada Lionel
AU  - Abdoul Karim Ouattara
AU  - Théodora Mahoukèdè Zohoncon
AU  - Jacques Simporé
Y1  - 2025/12/09
PY  - 2025
N1  - https://doi.org/10.11648/j.ajbio.20251306.13
DO  - 10.11648/j.ajbio.20251306.13
T2  - American Journal of BioScience
JF  - American Journal of BioScience
JO  - American Journal of BioScience
SP  - 210
EP  - 217
PB  - Science Publishing Group
SN  - 2330-0167
UR  - https://doi.org/10.11648/j.ajbio.20251306.13
AB  - The misuse of antibiotics promotes the development of multi-resistance in bacteria both biochemically and genetically, as well as its ability to transmit to other bacteria. These microorganisms are capable of simultaneously producing resistance enzymes through resistance mechanisms that allow them to resist various classes of antibiotics at the same time and thus become multi-resistant. Our objective was to study resistance to beta-lactams by Klebsiella co-producing resistance enzymes isolated at the Pietro Annigoni Research Center (CERBA). The isolation and purification of bacterial strains isolated from stools, vaginal swabs and urine of internal and external patients of CERBA, were carried out on selective media and Muller Hinton (MH). The antibiogram was carried out according to the disk diffusion method. The API 20E biochemical gallery (Bio Mérieux, France) was used for the identification of enterobacteria and the blaNDM, blaSHV and blaTOHO genes were detected by conventional Polymerase Chain Reaction (PCR). A total of one hundred and twenty-two (122) strains of Gram-negative bacilli were collected and identified. Among them we have 23.77% (29/122) strains of Klebsiella including 86.21% isolated from urine, 6.90% isolated from stool and 6.90% isolated from vaginal swab. The antibiogram showed that all 29 Klebsiella strains were resistant to at least one of the beta-lactams studied, including 93.10% resistance to amoxicillin plus clavulanic acid, 37.93% resistance to ceftazidime, 27.59% resistance to ceftriaxone, 44.83% to cefotaxime, 20.70% to imipenem and 24.14% to aztreonam. Among the 29 Klebsiella strains 24.13% were non-carriers of resistance genes and 76.86% of the strains were carriers of at least one of the resistance genes. However, 62.06% of Klebsiella strains harbor the bla SHV gene, 41.38% of strains harbored blaNDM versus 10.34% of strains carrying the bla TOHO gene. Among the Klebsiella strains, 37.93% of the strains had coexistences of the genes, blaSHV + blaNDM, blaSHV + blaTOHO and blaTOHO + blaNDM respectively. However, the blaSHV gene was most common in Klebsiella (Klebsiella sp and Klebsiella pneumoniae), followed by the bla NDM gene and the bla TOHO gene. This study has highlighted the multi-resistance of Klebsiella strains co-producing ESBLs of the blaNDM, blaSHV and blaTOHO type. The co-production of genes by certain strains, particularly Klebsiella strains, requires the development of new strategies in scientific research in order to find effective therapeutic solutions to destroy multi-resistant bacteria.
VL  - 13
IS  - 6
ER  -

Copy | Download

Author Information

Rhaina Olivia Badini

Biochemistry - Microbiology - Molecular Biology, Joseph KI-ZERBO University, Ouagadougou, Burkina Faso

Contact Email

http://orcid.org/0009-0007-5687-3387
Amana Mètuor Dabiré

Biochemistry - Microbiology, Daniel Ouezzin Coulibaly University, Dédougou, Burkina Faso

Contact Email

http://orcid.org/0000-0002-3898-4725
Rose Pêgdwendé Bonkoungou

Biochemistry - Microbiology - Molecular Biology, Joseph KI-ZERBO University, Ouagadougou, Burkina Faso

Contact Email

http://orcid.org/0009-0006-5089-4622
Rabiétou Nikiéma

Biochemistry - Microbiology - Molecular Biology, Joseph KI-ZERBO University, Ouagadougou, Burkina Faso

Contact Email

http://orcid.org/0009-0007-3679-2571
Bambara Eliada Lionel

Biochemistry - Microbiology - Molecular Biology, Joseph KI-ZERBO University, Ouagadougou, Burkina Faso

Contact Email

http://orcid.org/0009-0008-6549-3068
Abdoul Karim Ouattara

Biological Sciences, Norbert Zongo University, Koudougou, Burkina Faso

Contact Email

http://orcid.org/0000-0002-9767-0646
Théodora Mahoukèdè Zohoncon

Biochemistry - Microbiology - Molecular Biology, Joseph KI-ZERBO University, Ouagadougou, Burkina Faso;Molecular Biology and Genetics, Saint Thomas Aquinas University, Ouagadougou, Burkina Faso;Molecular Biology and Genetics, Pietro Annigoni Biomolecular Research Center, Ouagadougou, Burkina Faso

Contact Email

http://orcid.org/0000-0002-9100-0692
Jacques Simporé

Biochemistry - Microbiology - Molecular Biology, Joseph KI-ZERBO University, Ouagadougou, Burkina Faso;Molecular Biology and Genetics, Saint Thomas Aquinas University, Ouagadougou, Burkina Faso;Molecular Biology and Genetics, Pietro Annigoni Biomolecular Research Center, Ouagadougou, Burkina Faso

Contact Email

http://orcid.org/0000-0002-0415-9161

Download PDF

Submit an Article

Plain Text BibTeX RIS

APA Style

Badini, R. O., Dabiré, A. M., Bonkoungou, R. P., Nikiéma, R., Lionel, B. E., et al. (2025). Resistance to Beta-lactams by Klebsiella Co-Producing Resistance Enzymes at the Pietro Annigoni Research Centre (CERBA). American Journal of BioScience, 13(6), 210-217. https://doi.org/10.11648/j.ajbio.20251306.13

Copy | Download

ACS Style

Badini, R. O.; Dabiré, A. M.; Bonkoungou, R. P.; Nikiéma, R.; Lionel, B. E., et al. Resistance to Beta-lactams by Klebsiella Co-Producing Resistance Enzymes at the Pietro Annigoni Research Centre (CERBA). Am. J. BioScience 2025, 13(6), 210-217. doi: 10.11648/j.ajbio.20251306.13

Copy | Download

AMA Style

Badini RO, Dabiré AM, Bonkoungou RP, Nikiéma R, Lionel BE, et al. Resistance to Beta-lactams by Klebsiella Co-Producing Resistance Enzymes at the Pietro Annigoni Research Centre (CERBA). Am J BioScience. 2025;13(6):210-217. doi: 10.11648/j.ajbio.20251306.13

Copy | Download

@article{10.11648/j.ajbio.20251306.13,
  author = {Rhaina Olivia Badini and Amana Mètuor Dabiré and Rose Pêgdwendé Bonkoungou and Rabiétou Nikiéma and Bambara Eliada Lionel and Abdoul Karim Ouattara and Théodora Mahoukèdè Zohoncon and Jacques Simporé},
  title = {Resistance to Beta-lactams by Klebsiella Co-Producing Resistance Enzymes at the Pietro Annigoni Research Centre (CERBA)},
  journal = {American Journal of BioScience},
  volume = {13},
  number = {6},
  pages = {210-217},
  doi = {10.11648/j.ajbio.20251306.13},
  url = {https://doi.org/10.11648/j.ajbio.20251306.13},
  eprint = {https://article.sciencepublishinggroup.com/pdf/10.11648.j.ajbio.20251306.13},
  abstract = {The misuse of antibiotics promotes the development of multi-resistance in bacteria both biochemically and genetically, as well as its ability to transmit to other bacteria. These microorganisms are capable of simultaneously producing resistance enzymes through resistance mechanisms that allow them to resist various classes of antibiotics at the same time and thus become multi-resistant. Our objective was to study resistance to beta-lactams by Klebsiella co-producing resistance enzymes isolated at the Pietro Annigoni Research Center (CERBA). The isolation and purification of bacterial strains isolated from stools, vaginal swabs and urine of internal and external patients of CERBA, were carried out on selective media and Muller Hinton (MH). The antibiogram was carried out according to the disk diffusion method. The API 20E biochemical gallery (Bio Mérieux, France) was used for the identification of enterobacteria and the blaNDM, blaSHV and blaTOHO genes were detected by conventional Polymerase Chain Reaction (PCR). A total of one hundred and twenty-two (122) strains of Gram-negative bacilli were collected and identified. Among them we have 23.77% (29/122) strains of Klebsiella including 86.21% isolated from urine, 6.90% isolated from stool and 6.90% isolated from vaginal swab. The antibiogram showed that all 29 Klebsiella strains were resistant to at least one of the beta-lactams studied, including 93.10% resistance to amoxicillin plus clavulanic acid, 37.93% resistance to ceftazidime, 27.59% resistance to ceftriaxone, 44.83% to cefotaxime, 20.70% to imipenem and 24.14% to aztreonam. Among the 29 Klebsiella strains 24.13% were non-carriers of resistance genes and 76.86% of the strains were carriers of at least one of the resistance genes. However, 62.06% of Klebsiella strains harbor the bla SHV gene, 41.38% of strains harbored blaNDM versus 10.34% of strains carrying the bla TOHO gene. Among the Klebsiella strains, 37.93% of the strains had coexistences of the genes, blaSHV + blaNDM, blaSHV + blaTOHO and blaTOHO + blaNDM respectively. However, the blaSHV gene was most common in Klebsiella (Klebsiella sp and Klebsiella pneumoniae), followed by the bla NDM gene and the bla TOHO gene. This study has highlighted the multi-resistance of Klebsiella strains co-producing ESBLs of the blaNDM, blaSHV and blaTOHO type. The co-production of genes by certain strains, particularly Klebsiella strains, requires the development of new strategies in scientific research in order to find effective therapeutic solutions to destroy multi-resistant bacteria.},
 year = {2025}
}

Copy | Download

TY  - JOUR
T1  - Resistance to Beta-lactams by Klebsiella Co-Producing Resistance Enzymes at the Pietro Annigoni Research Centre (CERBA)
AU  - Rhaina Olivia Badini
AU  - Amana Mètuor Dabiré
AU  - Rose Pêgdwendé Bonkoungou
AU  - Rabiétou Nikiéma
AU  - Bambara Eliada Lionel
AU  - Abdoul Karim Ouattara
AU  - Théodora Mahoukèdè Zohoncon
AU  - Jacques Simporé
Y1  - 2025/12/09
PY  - 2025
N1  - https://doi.org/10.11648/j.ajbio.20251306.13
DO  - 10.11648/j.ajbio.20251306.13
T2  - American Journal of BioScience
JF  - American Journal of BioScience
JO  - American Journal of BioScience
SP  - 210
EP  - 217
PB  - Science Publishing Group
SN  - 2330-0167
UR  - https://doi.org/10.11648/j.ajbio.20251306.13
AB  - The misuse of antibiotics promotes the development of multi-resistance in bacteria both biochemically and genetically, as well as its ability to transmit to other bacteria. These microorganisms are capable of simultaneously producing resistance enzymes through resistance mechanisms that allow them to resist various classes of antibiotics at the same time and thus become multi-resistant. Our objective was to study resistance to beta-lactams by Klebsiella co-producing resistance enzymes isolated at the Pietro Annigoni Research Center (CERBA). The isolation and purification of bacterial strains isolated from stools, vaginal swabs and urine of internal and external patients of CERBA, were carried out on selective media and Muller Hinton (MH). The antibiogram was carried out according to the disk diffusion method. The API 20E biochemical gallery (Bio Mérieux, France) was used for the identification of enterobacteria and the blaNDM, blaSHV and blaTOHO genes were detected by conventional Polymerase Chain Reaction (PCR). A total of one hundred and twenty-two (122) strains of Gram-negative bacilli were collected and identified. Among them we have 23.77% (29/122) strains of Klebsiella including 86.21% isolated from urine, 6.90% isolated from stool and 6.90% isolated from vaginal swab. The antibiogram showed that all 29 Klebsiella strains were resistant to at least one of the beta-lactams studied, including 93.10% resistance to amoxicillin plus clavulanic acid, 37.93% resistance to ceftazidime, 27.59% resistance to ceftriaxone, 44.83% to cefotaxime, 20.70% to imipenem and 24.14% to aztreonam. Among the 29 Klebsiella strains 24.13% were non-carriers of resistance genes and 76.86% of the strains were carriers of at least one of the resistance genes. However, 62.06% of Klebsiella strains harbor the bla SHV gene, 41.38% of strains harbored blaNDM versus 10.34% of strains carrying the bla TOHO gene. Among the Klebsiella strains, 37.93% of the strains had coexistences of the genes, blaSHV + blaNDM, blaSHV + blaTOHO and blaTOHO + blaNDM respectively. However, the blaSHV gene was most common in Klebsiella (Klebsiella sp and Klebsiella pneumoniae), followed by the bla NDM gene and the bla TOHO gene. This study has highlighted the multi-resistance of Klebsiella strains co-producing ESBLs of the blaNDM, blaSHV and blaTOHO type. The co-production of genes by certain strains, particularly Klebsiella strains, requires the development of new strategies in scientific research in order to find effective therapeutic solutions to destroy multi-resistant bacteria.
VL  - 13
IS  - 6
ER  -

Copy | Download